Vitamin D-mediated modifications in protein-DNA interactions at two promoter elements of the osteocalcin gene
UMass Chan Affiliations
Department of Cell BiologyDocument Type
Journal ArticlePublication Date
1990-03-01Keywords
AnimalsBase Sequence
Calcitriol
Cell Line
DNA
DNA Probes
Deoxyribonuclease I
Gene Expression
Genes
Molecular Sequence Data
Nuclear Proteins
Nucleotide Mapping
Osteocalcin
Promoter Regions (Genetics)
Protein Binding
Rats
Transcription Factors
Life Sciences
Medicine and Health Sciences
Metadata
Show full item recordAbstract
By the combined use of DNase I footprinting, electrophoretic mobility-shift assay, and methylation interference analysis, we have identified a series of sequence-specific protein-DNA interactions in the 5' flanking region of the rat osteocalcin gene. Stimulation of osteocalcin gene expression by 1,25-dihydroxyvitamin D3, a physiologic mediator of this bone-specific gene in vitro and in vivo, is associated with modifications in the binding of ROS 17/2.8 cell nuclear factors to two promoter segments that up-regulate transcription. One segment located between -462 and -437 exhibits a vitamin D-dependent increase in sequence-specific binding of nuclear factors. This element (CTGGGTGAATGAGGACATTACTGACC), identified at single nucleotide resolution, contains a region of hyphenated dyad symmetry and shares sequence homology with consensus steroid-responsive elements and with the sequence that has been identified as the vitamin D receptor binding site in the human osteocalcin gene. We have also observed that vitamin D stimulation of osteocalcin gene expression results in a 5-fold increase in protein binding to the region of the osteocalcin box, a 24-nucleotide segment in the proximal promoter with a CCAAT motif as the central core. Our results demonstrate protein-DNA interactions in a vitamin D-responsive element and in a second sequence, the osteocalcin box, both of which are involved in the physiologic regulation of the osteocalcin gene in response to 1,25-dihydroxyvitamin D3.Source
Proc Natl Acad Sci U S A. 1990 Mar;87(5):1701-5.